ID: 1113195115_1113195121

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1113195115 1113195121
Species Human (GRCh38) Human (GRCh38)
Location 13:107794364-107794386 13:107794392-107794414
Sequence CCGGTACTATTAGAATTGCTCAG GAACTGGAAAGAGGGAGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 115} {0: 1, 1: 0, 2: 4, 3: 100, 4: 1184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!