ID: 1113217764_1113217768

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1113217764 1113217768
Species Human (GRCh38) Human (GRCh38)
Location 13:108062012-108062034 13:108062060-108062082
Sequence CCATGACCAATCCTGAAATGACA AATTCAAAATACCTGTTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!