ID: 1113249518_1113249529

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1113249518 1113249529
Species Human (GRCh38) Human (GRCh38)
Location 13:108436552-108436574 13:108436583-108436605
Sequence CCCCCACCCCACAACAGTCCCCG TGTTCCCTCTCCTGTGTCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!