|
Left Crispr |
Right Crispr |
| Crispr ID |
1113269319 |
1113269322 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:108655551-108655573
|
13:108655578-108655600
|
| Sequence |
CCTAGTGGAGCTTTGGGAAGAGA |
CCATCTTCCAGACCCCAGAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 218, 3: 2167, 4: 2606} |
{0: 67, 1: 862, 2: 1366, 3: 1582, 4: 1484} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|