ID: 1113271210_1113271215

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1113271210 1113271215
Species Human (GRCh38) Human (GRCh38)
Location 13:108676725-108676747 13:108676750-108676772
Sequence CCAGAAGCCAGAGGAGAGGCGTG TTGTTACTCTGGTAGTCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 25, 3: 123, 4: 475} {0: 1, 1: 0, 2: 1, 3: 4, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!