ID: 1113271792_1113271797

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1113271792 1113271797
Species Human (GRCh38) Human (GRCh38)
Location 13:108682673-108682695 13:108682694-108682716
Sequence CCTGGGCAGACCATGAGTCGTGC GCATGGAAGGGTCAGTGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49} {0: 1, 1: 0, 2: 2, 3: 34, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!