ID: 1113274425_1113274431

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1113274425 1113274431
Species Human (GRCh38) Human (GRCh38)
Location 13:108712718-108712740 13:108712744-108712766
Sequence CCCTGCTCCATCTGGTAAGAACC ACAGTCAGTGCCAGTGCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113} {0: 1, 1: 1, 2: 1, 3: 17, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!