ID: 1113313477_1113313483

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1113313477 1113313483
Species Human (GRCh38) Human (GRCh38)
Location 13:109154982-109155004 13:109155022-109155044
Sequence CCCCTTTATGGCAGGGACAGAAT TTCAGTTAGTTAAATTTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 178} {0: 1, 1: 0, 2: 2, 3: 46, 4: 497}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!