|
Left Crispr |
Right Crispr |
| Crispr ID |
1113374832 |
1113374848 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:109755513-109755535
|
13:109755554-109755576
|
| Sequence |
CCCCTTCCCAAAGCCCTTCCCTC |
TACAGTTGATTTTCAAAAGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 12, 3: 93, 4: 858} |
{0: 1, 1: 0, 2: 1, 3: 36, 4: 703} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|