ID: 1113379000_1113379008

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1113379000 1113379008
Species Human (GRCh38) Human (GRCh38)
Location 13:109786304-109786326 13:109786321-109786343
Sequence CCCCGGCTGCCTGCGGCCGCTGC CGCTGCCTCCTCGGGCTCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 513} {0: 1, 1: 0, 2: 1, 3: 19, 4: 529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!