ID: 1113379039_1113379041

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1113379039 1113379041
Species Human (GRCh38) Human (GRCh38)
Location 13:109786420-109786442 13:109786433-109786455
Sequence CCGCACCGGGGCTGCTGCCGCCG GCTGCCGCCGCGTCGCGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 256} {0: 1, 1: 0, 2: 0, 3: 16, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!