ID: 1113389123_1113389131

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1113389123 1113389131
Species Human (GRCh38) Human (GRCh38)
Location 13:109878958-109878980 13:109879004-109879026
Sequence CCTAATTTTTTTTCCAAAGGAAA TATGGGAATTTGCAGCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 132, 4: 1072} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!