ID: 1113393050_1113393061

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1113393050 1113393061
Species Human (GRCh38) Human (GRCh38)
Location 13:109916313-109916335 13:109916366-109916388
Sequence CCTTTGCTCCCCATGGAAACTCT TGACTACACCTGAGGGACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 232} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!