ID: 1113420653_1113420657

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1113420653 1113420657
Species Human (GRCh38) Human (GRCh38)
Location 13:110169430-110169452 13:110169462-110169484
Sequence CCAATAAAGATGTGGGTTACTGG AAGAAAGAACTGATTTAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 110} {0: 1, 1: 0, 2: 2, 3: 27, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!