ID: 1113437981_1113437988

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1113437981 1113437988
Species Human (GRCh38) Human (GRCh38)
Location 13:110307680-110307702 13:110307704-110307726
Sequence CCACAGGGGCCTAACGGGAGGCT TCCTTCTTTCCGGGTCGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 104} {0: 1, 1: 0, 2: 0, 3: 13, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!