ID: 1113437982_1113437990

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1113437982 1113437990
Species Human (GRCh38) Human (GRCh38)
Location 13:110307689-110307711 13:110307705-110307727
Sequence CCTAACGGGAGGCTCTCCTTCTT CCTTCTTTCCGGGTCGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 87} {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!