ID: 1113448442_1113448450

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113448442 1113448450
Species Human (GRCh38) Human (GRCh38)
Location 13:110388213-110388235 13:110388262-110388284
Sequence CCTCCAGGACGGCGGCAAGCGAG AGCCGCAGCCAGGCAGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 51} {0: 1, 1: 0, 2: 3, 3: 47, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!