ID: 1113459649_1113459666

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1113459649 1113459666
Species Human (GRCh38) Human (GRCh38)
Location 13:110472986-110473008 13:110473015-110473037
Sequence CCCCAGGTCCCATCGGCCTGCCA GATGGGCCCCCTGGGGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 164} {0: 1, 1: 1, 2: 3, 3: 37, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!