ID: 1113462857_1113462861

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1113462857 1113462861
Species Human (GRCh38) Human (GRCh38)
Location 13:110493852-110493874 13:110493876-110493898
Sequence CCTCACGAGGGAGAGCACCCGCT TCCCCTGTCACTTCTTATAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77} {0: 1, 1: 0, 2: 18, 3: 70, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!