ID: 1113472853_1113472860

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1113472853 1113472860
Species Human (GRCh38) Human (GRCh38)
Location 13:110559102-110559124 13:110559124-110559146
Sequence CCATCCACTGCCTGCCTTGCAGG GCTACAAGCAGCCAGGCATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 45, 4: 408} {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!