ID: 1113479469_1113479486

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1113479469 1113479486
Species Human (GRCh38) Human (GRCh38)
Location 13:110610012-110610034 13:110610054-110610076
Sequence CCCCCCCCCCCCCCCGGCATCAA TTGGCCATTGACACTGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 169, 4: 1320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!