ID: 1113484285_1113484286

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1113484285 1113484286
Species Human (GRCh38) Human (GRCh38)
Location 13:110642869-110642891 13:110642900-110642922
Sequence CCTGAGGATGAGGCTGGGGGGCA GCGCTTGCACACGTGTGTTTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 441} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!