ID: 1113507039_1113507046

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1113507039 1113507046
Species Human (GRCh38) Human (GRCh38)
Location 13:110824157-110824179 13:110824196-110824218
Sequence CCAGGCTGGTCCAATCTCTAAGC TCCTTCGCACTAAGGCTTTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!