ID: 1113514410_1113514411

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1113514410 1113514411
Species Human (GRCh38) Human (GRCh38)
Location 13:110881636-110881658 13:110881671-110881693
Sequence CCAGGGGAAATTCATATGAATTT AGTATAAACAATGTTTTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 277} {0: 1, 1: 0, 2: 3, 3: 43, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!