ID: 1113529220_1113529221

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1113529220 1113529221
Species Human (GRCh38) Human (GRCh38)
Location 13:111008207-111008229 13:111008220-111008242
Sequence CCATGTCAGTGCAGTCTTTTTTA GTCTTTTTTACATTATTAACTGG
Strand - +
Off-target summary No data {0: 3, 1: 10, 2: 7, 3: 26, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!