ID: 1113542966_1113542973

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1113542966 1113542973
Species Human (GRCh38) Human (GRCh38)
Location 13:111123186-111123208 13:111123236-111123258
Sequence CCAGGCCTTGGAAAGGCTTGCAC CTACCTCCGAGGAGACCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 130} {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!