ID: 1113549909_1113549923

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1113549909 1113549923
Species Human (GRCh38) Human (GRCh38)
Location 13:111184792-111184814 13:111184835-111184857
Sequence CCTGTGTGTGGGTTACCGGCCCC TGTGTGTCTGGGAGCAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 57} {0: 1, 1: 1, 2: 11, 3: 95, 4: 886}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!