ID: 1113552638_1113552649

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1113552638 1113552649
Species Human (GRCh38) Human (GRCh38)
Location 13:111205016-111205038 13:111205038-111205060
Sequence CCGTGAATGAGCTCACACTCCAG GAGGGGCAGGGGCGGGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 443} {0: 1, 1: 0, 2: 16, 3: 86, 4: 845}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!