ID: 1113564998_1113565008

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113564998 1113565008
Species Human (GRCh38) Human (GRCh38)
Location 13:111314432-111314454 13:111314469-111314491
Sequence CCATGGAAGGGTGGAGAGGACAC AGCCACACGCATCCATGGAAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 5, 3: 32, 4: 231} {0: 1, 1: 2, 2: 0, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!