ID: 1113568425_1113568430

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1113568425 1113568430
Species Human (GRCh38) Human (GRCh38)
Location 13:111335776-111335798 13:111335807-111335829
Sequence CCCAATGAAGCAGAGATCCAACC TGGTGTAAATGCATCACTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120} {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!