ID: 1113568842_1113568851

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113568842 1113568851
Species Human (GRCh38) Human (GRCh38)
Location 13:111339144-111339166 13:111339180-111339202
Sequence CCCTCGTGGCCACCTGGGGAGGC AGGCTGGGTTGGAGAAGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 227} {0: 1, 1: 0, 2: 15, 3: 192, 4: 834}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!