ID: 1113574422_1113574435

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113574422 1113574435
Species Human (GRCh38) Human (GRCh38)
Location 13:111383936-111383958 13:111383985-111384007
Sequence CCTCCACACCCCTCACGTCTTGC CCTGAGCTGCTCCGTGGCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 43, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!