ID: 1113590100_1113590112

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113590100 1113590112
Species Human (GRCh38) Human (GRCh38)
Location 13:111492713-111492735 13:111492762-111492784
Sequence CCTTTAAGAGACCAGCAAGGTGA TCCTGTGCAGCATAAATCTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!