ID: 1113590100_1113590114

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1113590100 1113590114
Species Human (GRCh38) Human (GRCh38)
Location 13:111492713-111492735 13:111492765-111492787
Sequence CCTTTAAGAGACCAGCAAGGTGA TGTGCAGCATAAATCTCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!