ID: 1113592273_1113592280

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113592273 1113592280
Species Human (GRCh38) Human (GRCh38)
Location 13:111509334-111509356 13:111509370-111509392
Sequence CCAGAGGGATGGAAGTTAGAGGC CGGCGATCAGCAGTGGTAGACGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 26, 3: 105, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!