ID: 1113605756_1113605762

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1113605756 1113605762
Species Human (GRCh38) Human (GRCh38)
Location 13:111604212-111604234 13:111604240-111604262
Sequence CCTTCTCGGCGATGCCACCGCGT TGGACTGATGCTGCCTCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 11} {0: 1, 1: 0, 2: 1, 3: 26, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!