ID: 1113606393_1113606394

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1113606393 1113606394
Species Human (GRCh38) Human (GRCh38)
Location 13:111610644-111610666 13:111610657-111610679
Sequence CCTGGAAGAGCTCAGGGTGGCCC AGGGTGGCCCTCAGCTCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 275} {0: 1, 1: 0, 2: 0, 3: 22, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!