ID: 1113610677_1113610686

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1113610677 1113610686
Species Human (GRCh38) Human (GRCh38)
Location 13:111642742-111642764 13:111642792-111642814
Sequence CCAGGTGTGCACACGTGCGTGAG TTTTACAGATCTGTGAAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 89} {0: 1, 1: 0, 2: 7, 3: 95, 4: 1245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!