ID: 1113653353_1113653359

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1113653353 1113653359
Species Human (GRCh38) Human (GRCh38)
Location 13:112053676-112053698 13:112053692-112053714
Sequence CCCCAGGGGCCGCCTCCGGTGCC CGGTGCCTAAACAAAGAAGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!