ID: 1113655915_1113655923

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1113655915 1113655923
Species Human (GRCh38) Human (GRCh38)
Location 13:112067735-112067757 13:112067752-112067774
Sequence CCGGGGCGGGCGGCGGCGGGGGC GGGGGCGGAGGCGGGGGCGGCGG
Strand - +
Off-target summary {0: 2, 1: 12, 2: 71, 3: 284, 4: 1325} {0: 3, 1: 113, 2: 370, 3: 2945, 4: 9325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!