|
Left Crispr |
Right Crispr |
| Crispr ID |
1113655915 |
1113655924 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:112067735-112067757
|
13:112067755-112067777
|
| Sequence |
CCGGGGCGGGCGGCGGCGGGGGC |
GGCGGAGGCGGGGGCGGCGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 12, 2: 71, 3: 284, 4: 1325} |
{0: 1, 1: 52, 2: 1551, 3: 2846, 4: 6929} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|