|
Left Crispr |
Right Crispr |
Crispr ID |
1113655915 |
1113655930 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:112067735-112067757
|
13:112067772-112067794
|
Sequence |
CCGGGGCGGGCGGCGGCGGGGGC |
CGGCGGCGGCGGGGGCGCCAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 12, 2: 71, 3: 284, 4: 1325} |
{0: 1, 1: 4, 2: 47, 3: 387, 4: 1234} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|