ID: 1113710564_1113710574 |
View in Genome Browser |
Spacer: 27 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1113710564 | 1113710574 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 13:112461757-112461779 | 13:112461807-112461829 |
Sequence | CCTGCAGAGAGACAGGGAAGCAG | ACGAAGCCTGCTGCAGTCTAAGG |
Strand | - | + |
Off-target summary | No data | {0: 1, 1: 0, 2: 1, 3: 7, 4: 78} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |