ID: 1113715212_1113715214

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1113715212 1113715214
Species Human (GRCh38) Human (GRCh38)
Location 13:112500230-112500252 13:112500246-112500268
Sequence CCCACTCATAATTTAAATAAGGC ATAAGGCATCTAAGCAAACTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 171} {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!