ID: 1113747769_1113747775

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1113747769 1113747775
Species Human (GRCh38) Human (GRCh38)
Location 13:112756808-112756830 13:112756830-112756852
Sequence CCAGCGAGGGGTCTGCTCCCAGC CACGGGGCCTGCTCCCAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 199} {0: 2, 1: 0, 2: 1, 3: 24, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!