ID: 1113752498_1113752507

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1113752498 1113752507
Species Human (GRCh38) Human (GRCh38)
Location 13:112785964-112785986 13:112786015-112786037
Sequence CCTTCAAAATGGATGAGCTAAAC TGGGGTAAACTGTGCTTTCCAGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 14, 4: 193} {0: 7, 1: 0, 2: 1, 3: 14, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!