ID: 1113752601_1113752606

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1113752601 1113752606
Species Human (GRCh38) Human (GRCh38)
Location 13:112786724-112786746 13:112786745-112786767
Sequence CCCACGCACACGCGTGGACGGGC GCTGCACATGGGGATGCCTGTGG
Strand - +
Off-target summary {0: 5, 1: 2, 2: 0, 3: 6, 4: 30} {0: 1, 1: 0, 2: 3, 3: 25, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!