|
Left Crispr |
Right Crispr |
| Crispr ID |
1113754317 |
1113754324 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:112799392-112799414
|
13:112799418-112799440
|
| Sequence |
CCGAGAAAGGAGTCAGCAAAGGG |
TGGAGGTGGGGCAGTTCTATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 139, 2: 94, 3: 523, 4: 1044} |
{0: 1, 1: 0, 2: 6, 3: 111, 4: 744} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|