ID: 1113768371_1113768396

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1113768371 1113768396
Species Human (GRCh38) Human (GRCh38)
Location 13:112894419-112894441 13:112894465-112894487
Sequence CCACGGGCGGCAGGTGCGCGCGG GGGGTGACGGGAGGGGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170} {0: 1, 1: 0, 2: 4, 3: 114, 4: 1067}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!