ID: 1113777202_1113777220

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1113777202 1113777220
Species Human (GRCh38) Human (GRCh38)
Location 13:112954593-112954615 13:112954634-112954656
Sequence CCCTCAGTGGGCTCTTCCCACTG AGGGGGCATGGGTGGGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 112, 4: 1058} {0: 1, 1: 0, 2: 3, 3: 35, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!